rs10152618 chr15:87121541 T>G
- Sequence
gacagtgagggtgtgagagttctg[T/G]aaccactcgtcatttatttactct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ATF7_HUMAN CTBP1_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF7_HUMAN | 1.94 | -1.94 | 1.00 | n/a | No Hit | |||
| CTBP1_HUMAN | 3.19 | -2.88 | 1.00 | n/a | n/a | |||
| FOXA1_HUMAN | 2.10 | -0.24 | 1.50 | -3.03 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP alcohol consumption, comorbid depressive syndrome and alcohol dependence, diabetic nephropathy in type 2 diabetes mellitus - end stage renal disease, infant head circumference, microalbuminuria, parkinsons disease, stabilized warfarin dose, urinary albumin-to-creatinine ratio