rs10152918 chr15:89808343 G>A
- Sequence
cctatgagctccattagctccaca[G/A]acctgttctgcaaagccccagaac
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -4.65 | 2.55 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP antidepressant efficacy in major depressive disorder improvement after 2 weeks of treatment, eye color, glioma, hdl cholesterol, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), triglycerides