rs10155434 chr4:143196499 G>A
- Sequence
ctcgtctcatttgacctgtcagca[G/A]tatttggcacagtcgatcactccc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -1.26 | 1.84 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, cystatin c in serum, hdl cholesterol, height, salmonella-induced pyroptosis, serum creatinine, systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Testis, Thyroid, Whole_Blood