rs1015670 chr19:2171491 G>A
- Sequence
gagacctttgcggttgtcaccacc[G/A]gggtgggggaagcccaaggatgct
- ASB in cell types
- HEK293 (embryonic kidney) GM02255 (Lymphoblastoid Cell Lines) L1236 (Hodgkin lymphoma) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- CTCF_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.39 | 0.75 | 1.28 | 2.73 | Concordant | |||
| GCR_HUMAN | 1.80 | -0.41 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, height, red blood cell count (rbc), total cholesterol, waist hip ratio
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood