rs10157026 chr1:245999853 C>G
- Sequence
cggaactcgaggttataaaatctg[C/G]tttaaaatcctggctcaatgactt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.23 | 0.99 | 1.17 | |||
| VCaP (prostate carcinoma) | 0.33 | 1.13 | 2.00 |
Items per page:
1 – 2 of 2