rs10158382 chr1:202076102 A>C
- Sequence
gtgctgtgatgagggactctgggg[A/C]ctgggagtgaataggccctgctga
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- KDM1A_HUMAN SOX6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | -0.50 | 1.61 | 3.00 | n/a | n/a | |||
| SOX6_HUMAN | n/a | 2.79 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, partial epilepsy, spine bone mineral density (bmd), stabilized warfarin dose, tetrology of fallot