rs1016027 chr7:85023672 A>C
- Sequence
aacttggcactaattagaatcatg[A/C]caaggctccaaaaacataatgtac
- ASB in cell types
- bipolar neuron GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 2.25 | -1.83 | 1.00 | |||
| GM02630 (Fanconi anemi) | -1.81 | 2.20 | 1.00 |
Items per page:
1 – 2 of 2