rs10161117 chr12:7995213 C>A
- Sequence
tctcgcaatttcctttccttttat[C/A]ttctccctgatcttctccctaaat
- ASB in cell types
- gastroesophageal sphincter neutrophils from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastroesophageal sphincter | 1.75 | -1.52 | 1.00 | |||
| neutrophils from periferal blood | 1.42 | -0.19 | 1.50 |
Items per page:
1 – 2 of 2