rs10161121 chr12:7995315 C>G
- Sequence
atacacaatccacaagccactgat[C/G]tcacctcagctgcacctatgctaa
- ASB in cell types
- adrenal gland 2588 (Lymphoblastoid Cell Lines) uterus ID00014 (lymphoblastoid cell, DiGeorge syndrome)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.97 | 0.03 | 1.30 | n/a | No Hit | |||
| RAD21_HUMAN | 2.13 | -1.60 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2