rs10162608 chr15:69225754 T>C
- Sequence
cctggcatcgatctaaacaattta[T/C]gtacattaactcatttaatactac
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.20 | 0.79 | 1.05 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, bipolar disorder, body mass index (bmi), hdl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, stabilized warfarin dose, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis