rs10162825 chr15:83733445 A>G
- Sequence
cctgttgggtagagactgtgagtc[A/G]cagcttctcaatgtgattggaatt
- ASB in cell types
- BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) TTC-1240 (Rhabdoid tumor of the kidney) PC3(bone mets prostate adenocarcinoma)
- ASB for transcription factors
- SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | 2.50 | -0.40 | 1.20 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Colon_Transverse, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid