rs10162898 chr15:70198164 G>A
- Sequence
gaggaaaggtgaagggagcctggc[G/A]cccttgctggttgtgaaatgatga
- ASB in cell types
- WA09 (embryonic stem cells) liver
- ASB for transcription factors
- AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 2.63 | -2.25 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence, comorbid depressive syndrome and alcohol dependence, triglycerides change with statins, urinary albumin-to-creatinine ratio