rs1016343 chr8:127081052 C>T
- Sequence
aagaccatgtgttacatttccctc[C/T]catgattactcacagcttcacagt
- ASB for transcription factors
- SMAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMAD3_HUMAN | 2.08 | -0.26 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP colorectal cancer, irritible bowel syndrome, ldl cholesterol, longstanding arthritis, parkinsons disease, prostate cancer, prostate cancer (advanced prostate cancer), prostate cancer (non-advanced prostate cancer)
PheWAS abnormal findings on radiological exam of musculoskeletal system, abnormal kidney function, acute cystitis, adjustment reaction, adverse effects of antineoplastic and immunosuppressive drugs, allergic conjunctivitis, alzheimers disease, arthropathy nos involving multiple sites, atherosclerosis of renal artery, bacterial enteritis, balanoposthitis, barretts esophagus, behcets syndrome, benign neoplasm of respiratory and intrathoracic organs, benign neoplasm of thyroid glands, bladder neck obstruction, bronchiectasis, bronchitis, cardiac and circulatory congenital anomalies, cardiac congenital anomalies, cardiac shunt/ heart septal defect, congenital anomalies of genital organs, conjunctivitis, noninfectious, cystitis, cystitis and urethritis, derangement of joint, non-traumatic, dermatomycoses, diseases of pancreas, diseases of the tongue, diseases of white blood cells, dislocation, diverticulitis, duodenal ulcer, dystrophy of female genital tract, elevated prostate specific antigen, fracture of hand or wrist, hemorrhage of gastrointestinal tract, hypersomnia, inflammatory diseases of prostate, iron deficiency anemia secondary to blood loss, mitral stenosis/insufficiency, noninfectious gastroenteritis, obsessive-compulsive disorder, open wound of eye or eyelid, otalgia, other cardiac conduction disorders, other conditions of brain, other hypertensive complications, other rheumatic heart disease, other specified osteoporosis, peptic ulcer, peripheral or central vertigo, pityriasis, pneumonia, poisoning by primarily systemic agents, posttraumatic stress disorder, primary thrombocytopenia, prostate cancer, renal colic, retinal detachments and defects, retinal edema and hypertensive retinopathy, sexual and gender identity disorders, symptoms/disorders of the urinary system, tinnitus, traumatic arthropathy, unspecified local infection of skin and subcutaneous tissue, urinary calculus, urinary complications, urinary incontinence, uveitis, vascular insufficiency of intestine