rs10165141 chr2:106104422 C>T
- Sequence
acaaggactatctcctccaccccg[C/T]gagccatgtttgcaatgggtcaga
- ASB in cell types
- neutrophils ovary erythroid cells liver
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils | n/a | 2.82 | 2.00 | |||
| ovary | 2.17 | -0.11 | 1.00 | |||
| erythroid cells | n/a | 2.48 | 2.00 | |||
| liver | 1.91 | -1.57 | 1.00 |
Items per page:
1 – 4 of 4