rs10165181 chr2:18387925 A>G
- Sequence
caacgacctaaccgaccagtagcc[A/G]actcagattcctgtcactataccc
- ASB in cell types
- erythroid cells CD34+ stem cells-derived erythroblasts HUVEC-C (HUVEC, umbilical vein endothelial cells) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 3.39 | n/a | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.76 | -4.99 | 2.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.54 | -0.97 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -0.24 | 0.97 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), height, ldl cholesterol change with statins, rheumatoid arthritis, transmission distortion