rs10167619 chr2:11697252 C>A
- Sequence
gtgctccccctgatcagcccccag[C/A]tgcttctggatacaaccgcactac
- ASB in cell types
- Kasumi-1 (acute myeloblastic leukemia)
- ASB for transcription factors
- MTG8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTG8_HUMAN | 2.36 | -0.12 | 1.46 | n/a | n/a |
Items per page:
1 – 1 of 1