rs10168009 chr2:3264461 T>G
- Sequence
cagcttgccatgccccagaagaac[T/G]ggataaagactttcctgtgtacgg
- ASB in cell types
- monocyte-derived dendritic cells MDM(monocyte derived macrophages) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.70 | -0.09 | 1.74 | -3.08 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
