rs10168193 chr2:169415592 A>G
- Sequence
gactatcacttgaatacatacagc[A/G]gtgtcttaagtgcacttctatgtt
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 1.64 | 0.55 | 1.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP microalbuminuria, partial epilepsy, sporadic creutzfeldt-jakob disease, total cholesterol, waist hip ratio