rs10168305 chr2:188291903 C>G
- Sequence
cggccgggagcgacccggagtccc[C/G]agccccgcgtcccagctgccgcca
- ASB in cell types
- MS-1 (Small cell lung carcinoma) LNCaP (prostate carcinoma) MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -2.39 | 2.76 | 1.00 | |||
| LNCaP (prostate carcinoma) | 2.19 | -0.04 | 2.45 | |||
| MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) | -0.09 | 1.47 | 1.00 | |||
| MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) | 1.38 | 0.48 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -1.47 | 2.04 | 1.00 |
Items per page:
1 – 5 of 5