rs10168780 chr2:222971749 G>T
- Sequence
cattgaggactggtgaggagagga[G/T]gtattcattttggtgtggggagga
- ASB in cell types
- H929 (plasma cell myeloma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.19 | -1.71 | 1.00 | |||
| A549 (lung carcinoma) | -0.12 | 0.86 | 2.05 |
Items per page:
1 – 2 of 2