rs10169091 chr2:86368524 A>C
- Sequence
aaaaaaaaaaaaaaaaaaaaaaaa[A/C]aacgcggtgggtgggaaggaggcg
- ASB in cell types
- 22RV1 (prostate carcinoma) foreskin keratinocyte GM18486 (Lymphoblastoid Cell Lines) SYO-1(Biphasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | -1.40 | 2.21 | 1.00 | |||
| foreskin keratinocyte | 1.57 | -4.33 | 2.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 0.67 | -0.61 | 1.00 | |||
| SYO-1(Biphasic synovial sarcoma) | n/a | 2.40 | 1.00 | |||
| gastrocnemius medialis | n/a | 2.19 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hdl cholesterol, refractive error, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio, years of education