rs10169712 chr2:20675238 G>C
- Sequence
aggccaagaggtctgagtcagatc[G/C]cgcagtgagctggagggagcgagg
- ASB in cell types
- MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
- ASB for transcription factors
- ZIC2_HUMAN CDN1B_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | -3.41 | 2.16 | 1.33 | 3.99 | Concordant | |||
| CDN1B_HUMAN | n/a | 2.62 | 2.00 | n/a | n/a | |||
| JUN_HUMAN | 0.05 | 1.82 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood