rs10169802 chr2:11753087 T>C
- Sequence
attatgggaacgccctcctgtccc[T/C]gggcaaggagggggatgagcaggg
- ASB in cell types
- MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MM1.S (plasma cell myeloma) | -3.29 | 1.89 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood