rs10171836 chr2:227130112 A>G
- Sequence
aaataaataacaaaaggtgttatc[A/G]acagtagacaatccagagactgga
- ASB in cell types
- GM02630 (Fanconi anemi) IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | -0.37 | 0.40 | 1.00 | |||
| IPSC-derived bipolar neuron | 1.17 | -0.95 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp), systolic blood pressure (sbp)