rs10171858 chr2:31170348 G>A
- Sequence
ggaaggtgccctccccacaaagaa[G/A]tctgtggagttcaccgtttttaag
- ASB in cell types
- erythroid cells GM12878 (female B-cells lymphoblastoid cell line) hepatocytes vagina
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 3.52 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.46 | 0.92 | 1.62 | |||
| hepatocytes | -1.18 | 1.71 | 1.00 | |||
| vagina | 1.76 | -0.92 | 1.00 |
Items per page:
1 – 4 of 4