rs10172004 chr2:68724345 C>T
- Sequence
catctggtctctaagcttagacta[C/T]ctgacacctaaatctataatgttt
- ASB in cell types
- SU-DHL-2 (anaplastic large cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | n/a | 3.60 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol change with statins, parkinsons disease, stabilized warfarin dose, systolic blood pressure (sbp), tetrology of fallot