rs10175530 chr2:136423922 A>C
- Sequence
gcgtgtgcacgagtgttcagggat[A/C]atgtgaacaagctgttctgttttt
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -0.16 | 2.25 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.85 | 0.09 | 1.00 |
Items per page:
1 – 2 of 2