rs10175942 chr2:43032025 C>T
- Sequence
gccatggcccagtggaaatcactg[C/T]gaaagtcattctccacatctccca
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma)
- ASB for transcription factors
- MYOD1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYOD1_HUMAN | -0.92 | 2.18 | 1.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), mitral annular calcium