rs10176769 chr2:112055586 G>A
- Sequence
cggagcgccaggtgcagcttcctg[G/A]tcaagatggtcgccgcctgccgct
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) SU-DHL-2 (anaplastic large cell lymphoma)
- ASB for transcription factors
- SPT5H_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPT5H_HUMAN | 0.14 | 1.48 | 1.00 | n/a | n/a | |||
| ZFX_HUMAN | 0.41 | 1.79 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood