rs10177049 chr2:238513528 G>T
- Sequence
tttaaaagaggccccagagagcta[G/T]tcttcttcctgttttccaccacgt
- ASB in cell types
- THP-1 (acute monocytic leukemia) MCF7L-P(immortalized breast epithelial cell line) CD34+ stem cells-derived erythroblasts hepatocytes
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.34 | 0.96 | 1.28 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis