rs10177513 chr2:189350801 A>G
- Sequence
aatattattcaccagaattagacc[A/G]gactagtcaacctcctggttatta
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRGR_HUMAN | 1.33 | -0.51 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), bipolar disorder, birth weight, diabetic retinopathy in type 2 diabetes mellitus, major depressive disorder, neuroticism
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Muscularis, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis