rs10178017 chr2:9753009 C>T
- Sequence
ggacacgggccctgggaactcgcc[C/T]ctgctgagttactctacttttggc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -0.06 | 1.39 | 1.22 | |||
| MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) | 0.03 | 1.11 | 2.00 |
Items per page:
1 – 2 of 2