rs10178845 chr2:8303673 G>A
- Sequence
ccacatcggagccatctagaaacc[G/A]atttgaacactgcttcttgtggtg
- ASB in cell types
- spleen CD14+ monocytes GM18951 (B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAT1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.62 | -4.48 | 2.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.19 | 2.08 | 1.40 | 0.27 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, asthma, comorbid depressive syndrome and alcohol dependence, eye color, total cholesterol, triglycerides, years of education