rs10180682 chr2:120254457 A>G
- Sequence
gatttccctctgcccgaggaatag[A/G]acattttcccaggattgtgtgtgg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -1.74 | 1.25 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood