rs10181869 chr2:102185392 C>A
- Sequence
tgctaagtttacaatacccggaat[C/A]agttctgccttcaaagccaagtgt
- ASB in cell types
- gastroesophageal sphincter spleen
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastroesophageal sphincter | -2.13 | 2.27 | 1.00 | |||
| spleen | -2.02 | 2.17 | 1.00 |
Items per page:
1 – 2 of 2