rs10183344 chr2:42196505 A>G
- Sequence
ggatctaaggataaattgagagtc[A/G]gctgcaatcaccaacaaatctaga
- ASB in cell types
- K562 (myelogenous leukemia) SK-N-SH (neuroblastoma) definitive endoderm from HUES8 SH-SY5Y (neuroblastoma)
- ASB for transcription factors
- DACH1_HUMAN COE3_HUMAN MTA1_HUMAN GATA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DACH1_HUMAN | 3.59 | n/a | 2.00 | n/a | n/a | |||
| COE3_HUMAN | 2.56 | -0.72 | 2.00 | n/a | No Hit | |||
| MTA1_HUMAN | 3.07 | n/a | 2.00 | n/a | n/a | |||
| GATA2_HUMAN | 2.44 | -2.02 | 1.50 | n/a | No Hit | |||
| NCOR1_HUMAN | 2.67 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, birth weight, body mass index (bmi), diastolic blood pressure (dbp), fasting blood glucose, systolic blood pressure (sbp), waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid