rs10185424 chr2:102046427 T>G
- Sequence
aatggtgtgttgtttctagatgtg[T/G]taacccaaagttcatgcagttttc
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | -0.29 | 1.57 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cortex, Cells_Cultured_fibroblasts, Liver, Lung, Skin_Sun_Exposed_Lower_leg, Whole_Blood