rs10185594 chr2:1742889 G>A
- Sequence
ccctgggagccgtggtctgtccca[G/A]cactttgtttcggaggtaggcgca
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- KDM2B_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM2B_HUMAN | -0.63 | 2.50 | 2.00 | n/a | n/a | |||
| GCR_HUMAN | -0.14 | 1.00 | 1.47 | 3.38 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg