rs10186441 chr2:43612909 G>A
- Sequence
aactttgagggcccagtgcaaaac[G/A]aaaatgcaggtcctcttcttcaaa
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | -0.91 | 1.60 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, hdl cholesterol, height, homa-b, serum creatinine, total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid