rs10187476 chr2:68063060 T>C
- Sequence
cacgagcggcgcttcccgatgatc[T/C]cacgctgctcgccacgccccctgc
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) CD34+ hematopoietic stem cells-derived proerythroblasts GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- STAG1_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.63 | -0.27 | 1.00 | n/a | n/a | |||
| GATA1_HUMAN | 2.10 | 0.10 | 1.67 | n/a | No Hit |
Items per page:
1 – 2 of 2