rs10191788 chr2:234572147 A>G
- Sequence
catacccaaagttatctcaaatgt[A/G]aacctgagttttagtctgcatgcc
- ASB in cell types
- germinal center B-cells macrophages form periferal blood naive IgD+ B cells
- ASB for transcription factors
- MEF2B_HUMAN FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 3.05 | n/a | 2.00 | n/a | No Hit | |||
| FOXP1_HUMAN | 2.31 | 0.01 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, cystatin c in serum, fasting insulin, salmonella-induced pyroptosis, triglycerides, years of education