rs10193797 chr2:133780258 A>C
- Sequence
ttgtgagctgctctcattcttata[A/C]attgatgatgaatctaaaactatg
- ASB in cell types
- A549 (lung carcinoma) foreskin keratinocyte CD34+ iPSC-differentiated NSC THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- SMCA4_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -2.11 | 2.60 | 1.00 | n/a | n/a | |||
| SMC3_HUMAN | 1.39 | 0.30 | 1.73 | n/a | n/a |
Items per page:
1 – 2 of 2