rs10194375 chr2:127082205 C>A
- Sequence
cactgactcccgggggctgtccct[C/A]tgtcaatctttccttgcccctcct
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.98 | -5.49 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, cystatin c in serum, late onset alzheimers disease (apoe4 carriers), plasma aldosterone concentration, rheumatoid arthritis, stabilized warfarin dose, years of education
GTEx eQTL Artery_Aorta, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood