rs10194420 chr2:179251084 T>C
- Sequence
tccataccacagaatactactcag[T/C]aattaaaaaggaactatggaaaca
- ASB for transcription factors
- SMCA5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA5_HUMAN | -2.43 | 2.54 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Lung, Spleen, Whole_Blood