rs10198562 chr2:50536432 A>G
- Sequence
tgcttgctgcccctttttctaatc[A/G]ttgcaatatataaatatttcttct
- ASB in cell types
- H929 (plasma cell myeloma) adrenal gland HEK293 (embryonic kidney) HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.27 | 2.07 | 1.68 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, diastolic blood pressure (dbp), ldl cholesterol, systolic blood pressure (sbp)