rs10200832 chr2:17148510 G>A
- Sequence
cgccaccctctgggaaaagcaggc[G/A]ctggtttgagcagttgagatagcc
- ASB in cell types
- K562 (myelogenous leukemia) GM19240 (B cells Lymphoblastoid Cell Lines) HMEC (human mammary epithelial cells) pancreas
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.10 | 1.42 | 1.06 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, abnormal involuntary movement scale, advanced age-related macular degeneration (geographic atrophy)