rs10201161 chr2:42063947 G>C
- Sequence
ttaacatgctttggtgtggcacct[G/C]tcagaggacgcttgaaagtgtaag
- ASB in cell types
- K562 (myelogenous leukemia) HASM2 (Human airway smooth muscle 2)
- ASB for transcription factors
- IKZF1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -1.66 | 2.62 | 2.00 | n/a | n/a | |||
| GCR_HUMAN | 1.11 | -0.40 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, height, infant head circumference, obesity with early age of onset (age >2)
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung