rs10202222 chr2:150614215 A>C
- Sequence
tcctttctaccccatcctctctca[A/C]acatttgcactcaggagcaagaaa
- ASB in cell types
- MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant) | 1.41 | 0.04 | 1.93 | |||
| 22RV1 (prostate carcinoma) | -1.61 | 2.26 | 2.00 |
Items per page:
1 – 2 of 2