rs10206340 chr2:222792834 A>C
- Sequence
ctatgtcactttctggaagccatc[A/C]ttttctctttatttccaaaataaa
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.13 | -0.94 | 2.00 | 2.55 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP aortic valve calcium, college completion, comorbid depressive syndrome and alcohol dependence, refractive error, years of education