rs10206343 chr2:45938833 T>C
- Sequence
tctctcaaacattggccctattcc[T/C]gatgtattagattgcaaacccctg
- ASB for transcription factors
- MAFK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAFK_HUMAN | -1.93 | 2.29 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, fasting insulin, hdl cholesterol, homa-b, homa-ir, obesity with early age of onset (age >2), sporadic creutzfeldt-jakob disease